|
Nature Biotechnology
proteowizard msconvert Proteowizard Msconvert, supplied by Nature Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/proteowizard msconvert/product/Nature Biotechnology Average 90 stars, based on 1 article reviews
proteowizard msconvert - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
SourceForge net
msconvert Msconvert, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/msconvert/product/SourceForge net Average 90 stars, based on 1 article reviews
msconvert - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
SourceForge net
msconvert proteowizard 3.0 Msconvert Proteowizard 3.0, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/msconvert proteowizard 3.0/product/SourceForge net Average 90 stars, based on 1 article reviews
msconvert proteowizard 3.0 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Matrix Science
mascot 2.4.1 Mascot 2.4.1, supplied by Matrix Science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mascot 2.4.1/product/Matrix Science Average 90 stars, based on 1 article reviews
mascot 2.4.1 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MassMatrix Inc
ms data file conversion v. 3.9 Ms Data File Conversion V. 3.9, supplied by MassMatrix Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ms data file conversion v. 3.9/product/MassMatrix Inc Average 90 stars, based on 1 article reviews
ms data file conversion v. 3.9 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Proteome Software Inc
scaffold software Scaffold Software, supplied by Proteome Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scaffold software/product/Proteome Software Inc Average 90 stars, based on 1 article reviews
scaffold software - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
GE Healthcare
superdex 200 pc  Superdex 200 Pc, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/superdex 200 pc/product/GE Healthcare Average 93 stars, based on 1 article reviews
superdex 200 pc - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
tggttatggtctgtagtctcgg recombinant dna cag icre druckmann Tggttatggtctgtagtctcgg Recombinant Dna Cag Icre Druckmann, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tggttatggtctgtagtctcgg recombinant dna cag icre druckmann/product/Addgene inc Average 93 stars, based on 1 article reviews
tggttatggtctgtagtctcgg recombinant dna cag icre druckmann - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
in house n a pucmini icap aav macpns1 pns1 chen In House N A Pucmini Icap Aav Macpns1 Pns1 Chen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/in house n a pucmini icap aav macpns1 pns1 chen/product/Addgene inc Average 94 stars, based on 1 article reviews
in house n a pucmini icap aav macpns1 pns1 chen - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Structure (London, England : 1993)
Article Title: Pih1p-Tah1p Puts a Lid on Hexameric AAA+ ATPases Rvb1/2p
doi: 10.1016/j.str.2017.08.002
Figure Lengend Snippet: KEY RESOURCE TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains Rosetta (DE3) EMD Millipore (Novagene) Cat# 70954 Chemicals, Peptides, and Recombinant Proteins Q5 site-specific mutagenesis kit New England Biolab Cat# E0554S BS 3 -d 0 /d 4 Thermo Scientific Cat# 21590/21595 Glutaraldehyde solution Sigma Aldrich Cat# G7651–10ML ProteoExtract all-in-one trypsin digestion kit Calbiochem Cat# 650212 Uranyl Formate Electron Microscopy Sciences Cat# 22450 Deposited Data Experimental map This paper EMD-8839 Recombinant DNA pHRvb1 This paper pRvb2 This paper AII-Rvb2p This paper pHPih1-Tah1 This paper pHNop58_447 This paper Software and Algorithms UltraScanIII ( Demeler, 2010 ) http://www.ultrascan3.uthscsa.edu/ US-SOMO ( Brookes et al., 2010 ) http://www.somo.uthscsa.edu/ Zeno ( Mansfield et al., 2001 ) https://doi.org/10.18434/T48W2J Appion ( Lander et al., 2009 ) http://www.appion.org ACE ( Mallick et al., 2005 ) http://nramm.scripps.edu/software/ace http://graphics.ucsd.edu/spmallick/research/ace CTFFIND ( Rohou and Grigorieff, 2015 ) http://grigoriefflab.janelia.org/ctf FindEM ( Roseman, 2004 ) Relion ( Scheres, 2012 ) http://www2.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page Frealign ( Grigorieff, 2016 ) http://grigoriefflab.janelia.org/frealign ProteoWizard MSConvert ( Chambers et al., 2012 ) http://proteowizard.sourceforge.net Chimera ( Pettersen et al., 2004 ) http://www.cgl.ucsf.edu/chimera/ Other Ni-NTA agrose Qiagen Cat# 30230
Techniques: Recombinant, Mutagenesis, Electron Microscopy, Software